Marta Pojo¹, Sofia Fragoso^1,2, Sidónia Santos^1,2, Patrícia Machado^1,2, Carla Simões²,Rafael Cabrera³,Teresa Pereira³, Wilfred FJ van IJcken⁴,Jorge Silva², Branca Cavaco1,Fátima Vaz^*2

1. Unidade de Investigação em Patobiologia Molecular (UIPM), Portugal

2. Grupo Multidisciplinar de Cancro da Mama, Ovário e Prostata Hereditários, Portugal

3. Serviço de Anatomia Patologia, Instituto Português de Oncologia de Lisboa Francisco Gentil E.P.E., Rua Prof. Lima Basto, 1099-023 Lisboa, Portugal

4. Center for Biomics, Erasmus University Medical Center, Rotterdam, The Netherlands

^*Corresponding author: Fátima Vaz,Clínica de Risco Familiar, Portugal.

Abstract

Background: Family history is a well-recognized risk factor for prostate cancer (PCa), but germline variants in BRCA1/2, and other DNA or mismatch repair genes explain less than half of hereditary cases. The identification of rare, highly penetrant PCa genes has been extremely challenging, and the role of polygenic risk adds to the complexity of this research. Methods: Integrated molecular genetic analysis of a family with clinical criteria for hereditary PCa: targeted BRCA1/2testing, multigene panel testing and whole-exome sequencing (WES). Bioinformatic and in silico analyses of WES data identified gene variants for protein studies and prevalence analysis in healthy controls. A functional viability study of the top candidate was performed to confirm its relevance in PCa. Results:no pathogenic variant either in targeted or commercial multigene testing was observed, but analysis of WES data identified ten variants of interest. After segregation studies and review of their functions, APOL2 and PELP1 genes were selected for protein expression studies. These suggested a higher APOL2 specificity for prostate tissue compared to PELP1; also, the APOL2 variant was not present in male controls, while the PELP1 variant was observed in 3% of these. Functional studies disclosed a decreased viability in APOL2-silenced PCa cell lines. Conclusions: The APOL2 gene is a good candidate for further studies in hereditary PCa.

Keywords: Familial prostate cancer, APOL2, susceptibility, mutation

Introduction

Prostate cancer (PCa), one of the leading causes of cancer-related deaths in men [1], is also one of the most heritable cancers[2]. This disease has been associated with several hereditary cancer syndromes and more than 100 common variants[3,4], but germline mutations in PCa patients were mostly found in BRCA2 (5%), ATM (2%), CHEK2 (2%), BRCA1(1%), RAD51D (0,4%),PALB2 (0,4%), ATR (0,3%) and NBN,PMS2,GEN1,MSH2,MSH6,RAD51C, MRE11A, BRIP1, HOXB13or FAM175A[5]. Most of these genes are directly or indirectly associated with DNA-repair and homologous recombination.If a pathogenicgermline variant is identified in those genes, it allows for cascade testing in family relativesand precision management regarding the prognosis and treatment of PCa patients. Indeed,a high frequency of BRCA2, CHECK2 and ATM [5, 6] variants were observed more frequently in men with advanced PCa[5] than in men with localized disease[7], and targeted treatment with PARPinhibitors are more effective inPCa patients with germline variants in those genes[8].

BRCA2 mutations have been associated with a 2- to 6-fold increase in the risk for prostate cancer[9-11]. Current guidelines recommend germlineBRCA1/2testing forPCa patients with familial history and patients with high-risk or metastatic disease[12]. Since PCa is included in the Hereditary Breast Ovarian Cancer (HBOC) syndrome, some authors defend changing its designation toKing Syndrome toinclude BRCA1/2testing in the routine management of PCa patients[13, 14]. Men with Lynch syndrome (germline mutations in MLH1, MSH2, MSH6, PMS2, or EPCAM) have a 2- to 5.8- fold increase in risk for prostate cancer[15]. However, there are no current NCCN guidelinesregarding any specific prostate cancer screening recommendations for men with this syndrome[12].

In the absence of a pathogenic germline variant, criteria for classifying a PCa family as hereditary include 1) three or more first-degree relatives with PCa, or 2) three successive generations of PCa, or 3) two relatives with PCa diagnosed at age ≤55 years [16]. Inherited cancer assessment and local resources may decide on BRCA1/2or MMR targeted screening based on family history of other cancers, or upfront or sequential multigene testing. Nevertheless, even with increasing access to testingpanels, including already known PCa genes, a significant number of these families will not identify a conclusive germline variant. In the era of precision medicine, these patientsand their families represent an unmet need in routine clinical practice.

In this study,we searched for new PCa genes throughan integrated clinical and molecular analysis of PCa and non-PCa patients belonging to a family with clinical criteria for hereditary PCa.

Material and Methods

Institutional approval

This study was approved by theEthics Committee of InstitutoPortuguês de Oncologia de LisboaFranciscoGentil (IPOLFG, UIC/829). PCaand control patients gave written informed consent to participate in the study.

Family pedigree, biological samples and sequential DNA testing

The pedigree of the family of interest for this study is shown in Figure 1. This family has African-Portuguese ancestry. Initially peripheral leukocyte DNA was obtained from PCa patients (III.1, III.2, III.3 and III.5) and targeted BRCA1/2testing was performed by CSCE (Conformational Sensitive Capillary Electrophoresis)]. In 2018, when III.5 was diagnosed with a second neoplasia (ductal biliary cancer), this patient consented on multigene testing (BRCA Hereditary Cancer MASTR Plus panel from Multiplicom, Niel, Belgium). This panel was run in a MiSeq NGS platform from Illumina.

Figure 1.Prostate cancer family pedigree. Six first-degree patients affected with prostate cancer are represented in this family with African-Portuguese ancestry.

Control DNA samples of 100 healthy males (average age: 62 years old) were requested from Biobanco-iMM, Lisbon Academic Medical Center, Lisbon, Portugal.

Whole exome sequencing (WES)

DNA was extracted from leukocytes as previously described [17]. Genomic DNA from 3 representative members of this family was analyzedthrough WES (patients III.1, III.3 and III.4, Figure 1).Whole exomesequencing was performed in the Erasmus Medical Center(Rotterdam, The Netherlands),using the SureSelect Human All Exon V4 capture kit (Agilent, Technologies, Santa Clara, California, USA).The captured exonic sequences were sequenced in a HiSeq2500 (Illumina Inc., San Diego CA, USA), with a v2 rapidflowcell for PE 100bp withindices. The reads were aligned against the human reference genome version GRCh38 using the BWA-backtrack software. Aligned reads were converted (SAM to BAM), and between 94% and 99% of reads were successfully mapped to the Human Genome.Duplicates were removed with Picard MarkedDuplicates and subsequenctly the variants were called using GATKv2 tool and annotated with Annovar.

Bioinformatic analysis

The bioinformatic analysis of the sequencing data was initially performed by Bioinf2Bio (Porto, Portugal).Briefly,fastq files were converted in SAM and then in BAM files, to enable easy visualization in the Integrative Genomics Viewer. IGV is a tool for interactive exploration of integrated genomic datasets, and to perform sequencing data analysis. The details of subsequent analyses were previously described [17].Selection of potential pathogenic variants was performed as shown in Figure 2.

Figure 2.WES data analysis workflow. Only variants with potential protein consequences were selected. Exclusion criteria related to allele frequency higher than 1% (in the global, European and African populations) and homozygous variants. Only variants validated by Sanger sequencing and segregated with PCa patients were included for further analyses.

Genetic variants’ validation

DNA from patients III-1, III-2, III-3, III-5, III-7, III-8, and III-9 were used for validation of variants’ selected after bioinformatic analysis (Figure 1 and Supplementary Table 1) as previously described in [17]. Primer sequences and PCR conditions melting are indicated in Table 1.

Table 1. Primer sequences and melting temperature (Tm). For each gene variant specific primers were designed.

Immunohistochemistry analysis

Protein expression of the genes of interest was analysed through staining of prostate cancer FFPE samples from patients III.2, III.3 and III.5. A benign gastric biopsy from family member III.6 (Figure 1) anda bone marrow sample from a sibling with multiple myeloma (III.7 Figure1) were also tested. Tissues sections were stained on a Ventana Benchmark Ultra using CC1 standard antigen retrieval. The primary antibody against APOL2 and PELP1 were used at a final dilution of 1:500 (Anti-APOL2 antibody (Invitrogen LTI A5-36425) and Anti-PELP1 (STJ24959). Positive controls (normal prostatetissue) were tested using the same antibodies. OptiView (Roche) was used as detection system. All samples werereviewedcentrally by an expert pathologist.

Cell culture

Prostate cancer cell lines, PC3 and LNCaPwere kindly supplied by Professor CarmenJerónimo, fromInstitutoPortuguês de Oncologia do Porto FG, EPE (IPO-Porto).Cells were cultured in RPMI medium with Hepes supplemented with 1% L-glutamine 1% antibiotic-antimycotic (all from Gibco®, Life Technologies, Paisley, UK), and 10% (v/v) fetal bovine serum (FBS) (Merck Millipore, Berlin, Germany). The cell lines were freeofmycoplasma by the universal mycoplasma detection kit (ATCC® 30-1012K™, Manassas, USA).

SiRNA transfection and cell viability

APOL2siRNA smart pool (D-017407-01, Dharmacon, CO, USA) andsiRNAcontrol non-targeting (D-001210-02-05, Dharmacon) wereindividually transfected into PC3 and LNCaP cells withDharmaFECT 1 transfection reagent (T-2001-02 Dharmacon, CO, USA) following the manufacturer's instructions. Cells were seeded in 6-well plates at an initial concentration of 6×104 PC3 cells/well and 9×104 LNCaP cells/well. After 48 hours the cells were harvested for cell viability assay by trypan blue (Gibco®, Life Technologies, Paisley, UK) exclusion assay.The viable cells were counted in a hemocytometer (0.100 mm, Neubauer Improved, Erlangen, Germany).

RNA extraction, cdna synthesis, and gene expression analyses

RNA was extracted from PCacell lines after 48hours of siRNA treatment using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol, and quantified by UV spectrophotometry (NanoDrop ND-1000). cDNA was synthesized from 1 μg of total RNA, using random primer p(dN)6 (Roche Diagnostics Corporation, Indianapolis, IN, USA) and SuperScript II reverse transcriptase (Thermos scientific, CA, USA).

APOL2 quantitative RT-PCR assays were performed with forward primer CACGCGCAGACCTTCGTT and reverse primer CCATGGAGGGCGGATTG. PCR amplifications were performed using 10 µM of each primer and Power SYBR Green PCR Master Mix (Applied Biosystems, CA USA), according to the manufacturer’s protocol. Hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) expression was used as endogenous control, with forward primer TGACACTGGCAAAACAATGCA and reverse primer GGTCCTTTTCACCAGCAAGCT.

Statistical analysis

All experiments were performed in at least three independent assays. The results are expressed as the mean + standard deviation. T-test was performed to assess statistical differences using GraphPad Prism software (version 5.0). p values <0.05 were considered statistically significant.

Results

Sequential DNA testing

No pathogenic BRCA1/2variants were identified in III.1, III.2, III.3 and III.5. Patient III.5 also consented on multigene testing after a second cancer diagnosis, but again no pathogenic variant was identified. Due to its likely autosomal dominant pattern of transmission, with no genetic cause identified, this family was selected for WES.

Whole exome sequencing and segregation analysis

WESwas performed onDNA from III.1, III.3 and III.5. A total of 29,995variants were shared by these patients (Figure 2), but several were excluded consideringcriteria such as the predicted high impact in protein function and prediction tools (SIFT and Polyphen). Only rare (<1%),heterozygousvariants shared by all patients with prostate cancer were selected forfurther analyses.Consequently,we obtained 13 rare, heterozygous and potentially functional variants (Figure 2). After validation by Sanger sequencing (Table 2) and segregation (Table 3), variants in 3 genes (KCNJ18, MUC6 and ZNF17 genes)were excluded. Segregation analysis for the resulting10 variants,including all available DNAs from family memberswas performed (Supplementary Table 1). Four variants in 4 different genes (ACIN1, APOL2, PELP1 and CIB1), were shared by the 4 affected male PCa patients:These variants led to a frameshiftin 3 cases: ACIN1,PELP1and APOL2and tosplice acceptor disruption (Table 3) in CIB1.Segregation studies revealedthat gene variants in detected ACIN1 and CIB1were shared by all siblings (males and females with or without any cancer history), suggesting that they could be benign polymorphisms. APOL2 and PELP1 were then selected for further studies.

Table 2. Whole exome sequencing variants selected for further studies

Table 3. Segregation analysis. Validation of variants by Sanger sequencing previously obtained in WES analysis.

Immunochemistry of tumor specimens

APOL2 and PELP1 protein expression was evaluated by immunostainingofcancer and normal adjacent prostate tissue of patients III.2, III.3 and III.5. Samples of benigngastric tissue (III.6) and multiple myeloma (III.7)from family relatives were also analyzed (Figure 3).

Figure 3.Immunostaining of PELP1 and APOL2 in pathology specimens.Prostate tumor samples (including adjacent normal tissue) from III.2, III.3 and III.5 and begnin gastritis (III.6) as well as multiple myeloma (III.7) specimens were analyzed.

APOL2, was clearly observed in the cytoplasm of prostatecells (similar between cancer and non-cancer cells), in contrast with other tissues (Figure 3). Indeed, although cytoplasmic staining in gastric epithelial cells, bone marrow megakaryocytes andendothelial cells could not be excluded, this was clearly different from prostate staining (III.6 and III.7, Figure 3).

As for PELP1, its expression was observed both in the nucleus and cytoplasm of both normal and neoplastic prostate, as well as in the other tissues tested (Figure 3).

Studies of PELP1and APOL2variants in healthy male controls

Although immunostaining suggested APOL2as a more prostate-specific gene, the role of PELP1in this family PCa could not be excluded. Although the frequency ofPELP1 and APOL2 gene variants is very low (< 1%) as reported in 1000 Genomes and Ensemble databases, we tested 100 healthy male controls for the variants of interest. As shown in Table 4, while the APOL2 variant was not found in any of the controls the variant in the PELP1 was found in 3% of those. Taken together these data, APOL2 was selected as the best candidate for functional studies.

Table 4. Frequency in healthy donors

Functional studies

Satisfactory levels of APOL2silencing after 48h of siRNA transfection, were obtained (> 60%) (Figure 4A) and we observed a significant reduction of cell viability (20% and 30% in PC3 and LNCaP, respectively) (Figure 4B), in both cell lines.

Figure 4.APOL2 silencing reduces prostate cancer cell lines viability. APOL2 mRNA expression (A) and cell viability (B) in prostate cell lines (PC3 and LNCaP) 48 hours after siRNA transfection (A) or APOL2 silencing (B).

Discussion

In this study,whole-exome sequencing analysis ofPCapatients belonging to a family with criteria for hereditary PCawas performed, since no pathogenic variant in known PCa genes had been previously identified, either by targeted BRCA1/2or multigene testing.After bioinformatic and segregation analysis,four variants of interest were observedin ACIN1, APOL2, PELP1, and CIB1genes. Further expression and functional studies identifiedAPOL2as the best candidate to explain the family phenotype.

Like many others in clinical practice, the family selected for this study fulfills criteria for hereditary PCa. However, commercially available tests did not disclose a genetic cause for the familial phenotype. Since several relatives consented to genetic and segregation studies, and DNA and pathology specimens, were available, searching for new PCa genes through WES was decided.

Bioinformatics’ analysis and stringent criteria to navigate the vast amount of WES data, allowed first the identification of variants in four genes (ACIN1, APOL2, PELP1 and CIB1), selected either because theywere predicted to be pathogenic based on in-silico prediction tools, or because of their previously described function[18-21].Segregation analysis further narrowed the candidates to APOL2 and PELP1, since thevariants in ACIN1(coding a caspase-3-activated protein required for apoptotic chromatin condensation [21-23]) and CIB1 (coding a calcium and integrin-binding protein 1 involved in cell survival, proliferation, migration, adhesion, and apoptosis [24]), genes were shared by all siblings. Additionally, CIB1 upregulation frequently correlates with oncogenic mutations of KRAS [27], and these are infrequent in PCa [24, 25].

APOL2 and PELP1geneshave an essential function in tissue homeostasis[18, 19], and our immunochemistry data revealed the maintenance of protein expression for both genes. These observations suggest that both frameshift variants (one in each gene) not affect protein expression, or the wild-type allele may have compensated for the frameshift variant identified. However, we observed a higher affinity of APOL2 for prostate tissue, since contrasting with PELP1, APOL2 expression was lower in all other tissues tested. Besides this higher affinity for prostate tissue, the PELP1 variant was observed in healthy male controls, selecting APOL2 as the top PCa candidate gene.

Is there a possible monogenic effect, for APOL2, that could explain the phenotype observed in the family included in this study? This geneencodesApolipoprotein L2, a protein found to be upregulated in the brains of African-Americans schizophrenic patients [25], with functionsmostly unknown [19]. APOL1 and APOL6 have been described as novel pro-death BH3-only proteins [19]that are also capable of regulating autophagy. APOL2 has also been associated with autophagy-mediated by Bcl-2 [19] and described as an anti-apoptotic protein in the human bronchial epithelium stimulated by the cytotoxic effects of IFN-γ [26]. APOL2 includes 6 exons, but most transcripts described include only 5 exons [27]. Importantly this gene was found to be highly expressed in the lung, pancreas, prostate, spleen, liver, and placenta [27]. We demonstrated that APOL2 silencing led to decreased viability in PCa cell lines.

Our study is the first to describe the association of APOL2 with PCa, but it is remarkable that its location on chromosome 22q.12, matches with one of the two recently identified PCa susceptibility loci[28, 29]. The functional studies we performed also add to the possible role of APOL2 in the modulation of prostate cancer cell survival, adding to its recognized functions of autophagy and apoptosis [32, 39].

Our data cannot exclude thePELP1 gene as a PCa gene of interest, involved either in monogenic or polygenic cancer risk. This gene encodes a protein expressed in both in the nucleus and cytoplasm [28]that is a co-regulator of several transcription factorsand a substrate of several kinases [31].It also functions as acoactivator of the estrogen receptor (ER) being upregulated in breast cancer [31], andis involved in the androgen receptor complex [30],which has beenproposed as a putative targeted therapy in PCa[30]. Neither PELP1, whose variant identified in this study may be a polymorphism, neither ACIN1norCIB1, can be excluded as PCagenes of interest for future studies.

Conclusion

In this study, and to our knowledge, theAPOL2 gene isassociated,for the first time, with PCa risk. Further to our research, its location on chromosome 22q.12, a recently identified PCa susceptibility locus[28, 29] reinforces APOL2 as a new PCa candidate gene.

Acknowledgements

This work was funded by Liga Portuguesa Contra o Cancro-Núcleo Regional do Sul (LPCC-NRS), Televisão Independente (TVI) and Instituto Português de Oncologia de Lisboa Francisco Gentil (IPOLFG), Lisboa, Portugal.The authors are also thankful to LPCC-NRSthatgranted the researcher Marta Pojo.iNOVA4Health Research Unit (LISBOA-01-0145-FEDER-007344), which is cofunded by Fundaçãopara a Ciência e Tecnologia/Ministério da Ciência e do Ensino Superior, through national funds.The authors are also grateful to the patients and their families for their co-operation.

Conflicts of Interest

The authors declare no conflict of interest

References

1. Bray F, Soerjomataram I.The Changing Global Burden of Cancer: Transitions in Human Development and Implications for Cancer Prevention and Control. In: Cancer: Disease Control Priorities, Third Edition (Volume 3). edn. Edited by Gelband H, Jha P, Sankaranarayanan R, Horton S. Washington (DC); 2015.

2. Mucci LA, Hjelmborg JB, Harris JR, et al. Familial Risk and Heritability of Cancer Among Twins in Nordic Countries. Jama 2016;315(1):68-76.

3. Carter BS, Beaty TH, Steinberg GD, et al. Mendelian inheritance of familial prostate cancer. Proceedings of the National Academy of Sciences of the United States of America 1992;89(8):3367-3371.

4. Mateo J, Cheng HH, Beltran H, et al. Clinical Outcome of Prostate Cancer Patients with Germline DNA Repair Mutations: Retrospective Analysis from an International Study. Euro Urology2018; 73(5):687-693.

5. Pritchard CC, Mateo J, Walsh MF, et al. Inherited DNA-Repair Gene Mutations in Men with Metastatic Prostate Cancer. The New England J of Med.2016;375(5):443-453.

6. Isaacsson Velho P, Silberstein JL, Markowski MC, et al. Intraductal/ductal histology and lymphovascular invasion are associated with germline DNA-repair gene mutations in prostate cancer. The Prostate. 2018; 78(5):401-407.

7. Leongamornlert DA, Saunders EJ, Wakerell S, et al. Germline DNA Repair Gene Mutations in Young-onset Prostate Cancer Cases in the UK: Evidence for a More Extensive Genetic Panel. European urology 2019; 76(3):329-337.

8. Mateo J, Carreira S, Sandhu S, et al. DNA-Repair Defects and Olaparib in Metastatic Prostate Cancer. The New England J of Med. 2015; 373(18):1697-1708.

9. Leongamornlert D, Mahmud N, Tymrakiewicz M, et al. Germline BRCA1 mutations increase prostate cancer risk. Brit J of Cancer.2012; 106(10):1697-1701.

10. Agalliu I, Gern R, Leanza S, et al. Associations of high-grade prostate cancer with BRCA1 and BRCA2 founder mutations. Clin Cancer Res. 2009;15(3):1112-1120.

11. Gallagher DJ, Gaudet MM, Pal P, et al. Germline BRCA mutations denote a clinicopathologic subset of prostate cancer. Clin Cancer Res.2010;16(7):2115-2121.

12. Mohler JL, Antonarakis ES, Armstrong AJ, et al. Prostate Cancer, Version 2.2019, NCCN JClinOncol. JNCCN 2019; 17(5):479-505.

13. Marabelli M, Calvello M, Bonanni B.Cancer: more genetic BRCA testing for men. Nature 2019; 573(7774):346.

14. Pritchard CC.New name for breast-cancer syndrome could help to save lives. Nature 2019;571(7763):27-29.

15. Engel C, Loeffler M, Steinke V, et al. TO Risks of less common cancers in proven mutation carriers with lynch syndrome. JClinOncol. 2012;30(35):4409-4415.

16. Hampel H, Bennett RL, Buchanan A, et al. Guideline Development Group ACoMG, Genomics Professional P, Guidelines C, National Society of Genetic Counselors Practice Guidelines C: A practice guideline from the American College of Medical Genetics and Genomics and the National Society of Genetic Counselors: referral indications for cancer predisposition assessment. Genetics in medicine : official journal of the American College of Medical Genetics 2015;17(1):70-87.

17. Campos C, Fragoso S, Luis R, et al. High-Throughput Sequencing Identifies 3 Novel Susceptibility Genes for Hereditary Melanoma. Genes 2020, 11(4).

18. Sareddy GR, Vadlamudi RK.PELP1Structure, biological function and clinical significance. Gene 2016; 585(1):128-134.

19. Galindo-Moreno J, Iurlaro R, El Mjiyad N, et al. Apolipoprotein L2 contains a BH3-like domain but it does not behave as a BH3-only protein. Cell Death Dis.2014; 5:e1275.

20. Wang X, Peng X, Zhang X, et al. The Emerging Roles of CIB1 in Cancer. Cellular physiology and biochemistry: Cell. Physiol. Biochem. 2017;43(4):1413-1424.

21. Sahara S, Aoto M, Eguchi Y, et al. Acinus is a caspase-3-activated protein required for apoptotic chromatin condensation. Nature.1999; 401(6749):168-173.

22. Moul JW, Friedrichs PA, Lance RS, et al. Infrequent RAS oncogene mutations in human prostate cancer. Prostate J. 1992; 20(4):327-338.

23. Salmaninejad A, Ghadami S, Dizaji MZ, et al. Molecular Characterization of KRAS, BRAF, and EGFR Genes in Cases with Prostatic Adenocarcinoma; Reporting Bioinformatics Description and Recurrent Mutations. Clinical laboratory. 2015; 61(7):749-759.

24. Black JL, Harrell JC, Leisner TM, et al. CIB1 depletion impairs cell survival and tumor growth in triple-negative breast cancer. Breast Cancer Res Tr. 2015;152(2):337-346.

25. Takahashi S, Cui YH, Han YH, et al. Association of SNPs and haplotypes in APOL1, 2 and 4 with schizophrenia. Schizophr. Res. 2008;104(1-3):153-164.

26. Liao W, Goh FY, Betts RJ, et al. A novel anti-apoptotic role for apolipoprotein L2 in IFN-gamma-induced cytotoxicity in human bronchial epithelial cells. J. Cell. Physiol.2011;226(2):397-406.

27. Duchateau PN, Pullinger CR, Cho MH, et al. Apolipoprotein L gene family: tissue-specific expression, splicing, promoter regions; discovery of a new gene. J Lipid Res. 2001;42(4):620-630.

28. Conti DV, Wang K, Sheng X, et al. Two Novel Susceptibility Loci for Prostate Cancer in Men of African Ancestry. J Natl Cancer I.2017;109(8).

29. Camp NJ, Farnham JM, Cannon-Albright LALocalization of a prostate cancer predisposition gene to an 880-kb region on chromosome 22q12.3 in Utah high-risk pedigrees.Cancer Res..2006; 66(20):10205-10212.

30. Yang L, Ravindranathan P, Ramanan M, et al. Central role for PELP1 in nonandrogenic activation of the androgen receptor in prostate cancer. JMolEndocrinol. 2012; 26(4):550-561.

Received: April 29, 2020;
Accepted: May 19, 2020;
Published: May 21, 2020.

To cite this article : Pojo M,Fragoso S, Santos S,et al.APOL2: A New Candidate Gene Associated with Hereditary Prostate Cancer. British Journal of Cancer Research. 2020;3:3.

©Pojo M,et al.2020.